Nghiên cứu một số đặc tính sinh học của vi rút cúm A H5N1 Clade 7 phân lập ở Việt Nam

Xem tất cả 162 trang, được chia thành 20 bài viết trong tài liệu này. Không yêu cầu đăng nhập hay tải về.

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở Việt Nam - 20

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở Việt Nam - 20

A/CHICKEN/VIETNAM/NCVD-016/200 AAAAGGGTTTTCATTTAAATACGGCAATGGTGTTTGGATCGGGAGAACCAAAAGCACTAATTCCAGGAGC A/CHICKEN/VIETNAM/NCVD-03/2008 . A/CHICKEN/VIETNAM/NCVD-04/2008 . A/CHICKEN/VIETNAM/NCVD-05/2008 . A/CHICKEN/VIETNAM/NCVD-093/200 . 1060 1070 1080 1090 1100 1110 1120 .|.|.|.|.|.|.|.|.|.|.|.|.|.| ...

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở Việt Nam - 19

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở Việt Nam - 19

CÁC CÔNG TR NH ĐÃ CÔNG BỐ LIÊN QUAN ĐẾN LUẬN ÁN 1. Nguyễn Tùng , Đỗ Thị Hoa, Ngô Thị Thu Hương, Nguyễn Văn Cảm, Nguyễn Bá Hiên (2011), “Xác định một số đặc tính sinh học của virus cúm gia cầm độc lực cao H N1 nhánh phân lập Việt ...

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở Việt Nam - 18

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở Việt Nam - 18

Guan Y, Peiris JS, Lipatov AS, Ellis TM, Dyrting KC, Krauss S (2002) Emergence of multiple genotypes of H5N1 avian influenza viruses in Hong Kong SAR. Proc Natl Acad Sci USA 99: 8950-8955. Guan Y, Poon LL, Cheung CY, Ellis TM, Lim W, Lipatov AS (2004) H5N1 influenza: a protean pandemic threat. Proc ...

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở Việt Nam - 17

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở Việt Nam - 17

1 gà ốm nặng đã chết (ĐC 4) vào ngày thứ tư, 2 gà chết vào ngày thứ năm (ĐC 2 và ĐC 3), 2 gà còn lại đều bỏ ăn. - Từ ngày thứ sáu sau khi công, gà ốm lô tiêm vacxin đã hồi ph c, ăn uống tr lại bình thường như các gà khác trong cùng ...

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở Việt Nam - 16

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở Việt Nam - 16

Kết quả xét nghiệm vi thể, khá tương đồng với kết quả xét nghiệm RRT- PCR cũng cho thấy virus H N1 đã tấn công vào hầu hết các khí quan phủ tạng với mức độ tổn thương rất khác nhau. 4 1 4 3 2 A B hổi (nhuộ H , X 400) Cơ ti (nhuộ H , X ...

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở Việt Nam - 15

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở Việt Nam - 15

Cứu để hiểu rõ đặc tính gây bệnh của từng chủng virus đối với từng loài gia cầm khác nhau. 3.3.4. Kết quả đ nh gi đ bài thải củ i t ên đ ng vật thí nghiệm gây nhiễ Bên cạnh việc theo dõi lâm sàng hàng ngày trong suốt thời gian ...

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở Việt Nam - 14

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở Việt Nam - 14

Bảng 3.14: Kết quả đ nh gi đ c lực của virus c A/H5N1c A/H5N1 cl de 7 t ên gi cầm Lần thí nghiệm Động vật thí nghiệm Số lượng (con) Chết (con) Tỷ lệ(%) Điểm lâm sàng Thời gian chết trung bình ( DT) (ngày) Lần 1 Gà 11 11 100 1,9 5,4 Vịt 10 0 0 0 ...

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở Việt Nam - 13

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở Việt Nam - 13

- Ở nồng độ 10 -4 toàn bộ số phôi trứng chết trong ngày thứ hai, trong khoảng 40-48 giờ sau khi nhiễm. - Nồng độ 10 -5 cũng giết chết toàn bộ phôi trứng nhưng trong thời gian lâu hơn so với nồng độ 10 -3 và 10 -4 , nhưng cũng không quá 2h ...

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở Việt Nam - 12

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở Việt Nam - 12

67 A/CHICKEN/VIETNAM/NCVD-04/2008 52 94 94 83 91 A/CHICKEN/VIETNAM/NCVD-05/2008 A/CHICKEN/VIETNAM/NCVD-093/2008 A/CHICKEN/VIETNAM/NCVD-03/2008 A/CHICKEN/VIETNAM/NCVD-016/2008 Clade 7 83 35 A/chicken/Shanxi/10/2006 2006 A/chicken/Shandong/A-10/2006 2006 A/chicken/Shanxi/2/2006 Clade 7 33 33 ...

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở Việt Nam - 11

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở Việt Nam - 11

Hình 3.3. Hiện tượng chèn à xó c c xit in tại vị t í cle ge ite củ c c chủng i A/H5N1 cl de 7 phân lập ở Việt N 3.2.2. Giải t ình tự gen NA(N1) à phân tích cây phả hệ dự t ên ch ỗi nucleotide của gen N1 Gen NA của virus cúm gia cầm cùng với gen ...

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở Việt Nam - 10

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở Việt Nam - 10

Tên của các mẫu đã phân lập được virus cúm A/H5N1và tên của các mẫu NA đã phát hiện dương tính virus cúm A/H5N1 được đặt theo danh pháp quốc tế: Tên type cúm A Loài Tên nước Tên viết tắt Trung tâm Chẩn đoán Thú y Trung ương b ng ...

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở Việt Nam - 9

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở Việt Nam - 9

 Nhuộm b ng Haematoxylin trong 3 phút, sau đó nửa qua vòi nước chảy  Rửa b ng nước cất, sau đó rút nước (b ng cách nhúng qua cồn 90, cồn tuyệt đối: 2 lần, xylen: 2 lần)  Gắn lamen 2.3.2.11. hương ph p giải t ình tự gen - Chiết tách NA ...

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở Việt Nam - 8

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở Việt Nam - 8

- Phòng Virus – Trung tâm Chẩn đoán Thú y Trung ương - C c Thú y. - Bộ phận Cúm (Influenza Division), Trung tâm Phòng chống dịch bệnh CDC – Hoa Kỳ 2.3. Vật liệ à phương ph p nghiên cứu: 2.3.1. Vật liệ nghiên cứu  Dịch swab (ngoáy ổ nhớp) từ ...

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở Việt Nam - 7

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở Việt Nam - 7

1.3.8. Bệnh tích của gia cầm mắc c gi cầm 1.3.8.1. Bệnh tích đại th Bệnh tích đại thể các loài khác nhau có biểu hiện khác nhau. Đối với gà, bệnh tích thường gặp là mào, tích sưng to, tím tái phù quanh mí mắt. Thể nhẹ, bệnh tích các ...

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở Việt Nam - 6

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở Việt Nam - 6

Một số virus A/H5N1 thuộc clade được phân lập biên giới phía Bắc và một số chợ gia cầm sống phía Bắc Việt Nam. Sự phân bố của các virus A/H5N1 thuộc các clade khác nhau đã được thu thập và phân tích được trình bày trong bản đồ ...

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở Việt Nam - 5

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở Việt Nam - 5

NA, hoặc cả hai gen của các chủng virus cúm A đã thích nghi người, để tạo ra một biến chủng virus mới thích ứng lây nhiễm dễ dàng người, gây ra nguy cơ của một đại dịch cúm mới và đặt ra một định hướng mới trong phòng chống ...

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở Việt Nam - 4

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở Việt Nam - 4

Gồm một số amino acid mang tính kiềm được mã hóa b i một chuỗi oligonucleotide, đó là điểm cắt của enzym protease, đây là vùng quyết định độc lực của virus (Bosch và cs, 1981; Gambotto và cs, 2008). Protein HA có khối lượng phân tử khoảng ...

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở Việt Nam - 3

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở Việt Nam - 3

Đặc biệt, đã có nhiều người nhiễm và bị tử vong do virus cúm H N1, theo thống kê số người bị nhiễm cúm gia cầm H5N1 của các nước báo cáo với Tổ chức Y tế thế giới (WHO) từ th ng 12 2003 đến 12/4/2012, đã có tới 602 trường hợp ...

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở Việt Nam - 2

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở Việt Nam - 2

DANH M C CÁC H NH TT Tên hình Trang 1.1. Bản đồ phân bố các ca cúm A/H5N1trên thế giới (tính đến 2009) 5 1.2. Biểu đồ biểu diễn dịch cúm gia cầm do virus cúm A/H5N1 theo thời gian 8 1.3. (A) ô phỏng hình thái của virus cúm, (B) Hình thái kính hiển ...

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở Việt Nam - 1

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở Việt Nam - 1

BỘ GIÁO DỤC VÀ ĐÀO TẠO TRƯỜNG ĐẠI HỌC NÔNG NGHIỆ H N I NGUYỄN TÙNG NGHIÊN CỨU M T SỐ ĐẶC TÍNH SINH HỌC CỦA VI RÚT CÚM A/H5N1 CLADE 7 HÂN LẬ Ở VIỆT NAM CHUYÊN NG NH: KÝ SINH TRÙNG V VI SINH VẬT HỌC THÚ Y MÃ SỐ: 62.64.01.04 NGƯỜI HƯỚNG ...

Bài viết tương tự

Xem nhiều

Bài viết mới

Home | Contact | About | Terms | Privacy policy
© 2022 Tailieuthamkhao.com | all rights reserved

Trang chủ Tài liệu miễn phí