Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở Việt Nam - 8

Digg Facebook Google LinkedIn Pinterest Reddit Tumblr Twitter
2

Nội dung:

- Phòng Virus – Trung tâm Chẩn đoán Thú y Trung ương - C c Thú y.

- Bộ phận Cúm (Influenza Division), Trung tâm Phòng chống dịch bệnh CDC – Hoa Kỳ

2.3. Vật liệ à phương ph p nghiên cứu:

2.3.1. Vật liệ nghiên cứu

Dịch swab (ngoáy ổ nhớp) từ gà nhập lậu.

Virus cúm A/H5N1 phân lập từ dịch swab.

Phôi trứng gà 9-10 ngày tuổi (lấy từ gà khỏe mạnh, chưa tiêm phòng vacxin cúm gia cầm), tế bào xơ phôi gà chế từ phôi gà 8 ngày tuổi.

Gia cầm (gà, vịt và ngan) khỏe mạnh chưa tiêm phòng vacxin cúm gia cầm và không có kháng thể cúm gia cầm lấy từ cơ s chuyên cung cấp động vật thí nghiệm của Trung tâm Chẩn đoán Thú y Trung ương.

Vacxin cúm gia cầm A/H N1 e-1do Trung Quốc sản xuất.

Kháng nguyên và kháng thể chuẩn cúm gia cầm H5N1 (do CDC - Hoa Kỳ cung cấp).

Kít chiết tách RNeasy minikit (công ty Qiagen) và Kít realtime T- PCR Invitrogen superscriptIII (công ty Invitrogen).

Primer và probe cho H N1, Primer và kít để giải trình tự gen (CDC- Hoa Kỳ).

2.3.2. hương ph p nghiên cứu

2.3.2.1. hương ph p điề t hồi cứ

Khi giải trình tự gen và phân tích cây phát sinh loài của virus A/H5N1 clade , điều tra ngược lại các mẫu đã được xét nghiệm trong phòng thí nghiệm từ cùng nguồn.

2.3.2.2. hương ph p phân lập i t ên ph i t ứng gà

- Bệnh phẩm là dịch swab (ngoáy ổ nhớp của gà) từ gà nhập lậu được xử lý b ng cách lắc ống dịch swab có tăm bông bên trong, rồi ly tâm sau đó chuyển dịch nổi sang ống 1, ml và vô trùng b ng kháng sinh.

- Sử d ng phôi trứng gà 9-10 ngày tuổi.

- Tiêm 0,2 ml dịch bệnh phẩm vào xoang niệu mô của phôi trứng gà, tiếp t c ấp nhiệt độ 37oC đến 96 giờ, soi trứng hàng ngày, thu trứng chết và kiểm tra b ng phản ứng HA để xác định khả năng gây ngưng kết hồng cầu gà và phản ứng HI với kháng thể chuẩn kháng virus cúm gia cầm và kháng thể chuẩn kháng virus Newcastle để giám định virus phân lập được.

- Phôi trứng được giữ tủ mát 2 - 8oC ít nhất 2 giờ trước khi thu hoạch

dịch niệu mô. Dùng syringe ml hoặc 10 ml thu dịch niệu mô b ng cách đâm xuyên qua nắp buồng hơi. Dịch niệu mô được chia thành nhiều ống nhỏ (0,5 ml/ống) giữ nhiệt độ -70oC.

2.3.2.3. X c định ch EID50

- Để tính EID50, virus cũng được pha loãng thành nhiều nồng độ theo cơ số 10 (ví d 10-1, 10-2….10-8) và tiêm vào xoang niệu mô của phôi trứng, mỗi nồng độ phôi, mỗi phôi 0,1 ml dịch virus, ấp tủ ấp 370C tới 96 giờ.

- Soi trứng hàng ngày để kiểm tra phôi sống và phôi chết, thu các trứng chết và trứng sống, thu hoạch nước trứng. Thực hiện phản ứng HA đối với nước trứng. ẫu nào có phản ứng HA dương tính, được coi là nhiễm virus A/H5N1 . Sử d ng công thức Reed- eunch để xác định chỉ số EID50 của virus.

2.3.2.4. X c định ch TCID50

- Sử d ng môi trường tế bào xơ phôi gà chế từ phôi trứng gà 9-10 ngày tuổi để chuẩn độ virus cúm gia cầm: Tế bào được nuôi cấy trên đĩa 96 giếng (lượng tế bào là x104 tế bào 100 µl giếng). Virus được pha loãng theo các nồng độ 10-2 - 10-8 với môi trường Eagle’s E , mỗi nồng độ 5 giếng, mỗi giếng 100

µl dung dịch virus đã pha loãng các nồng độ đã xác định. Quan sát CPE sau 2 ngày. Sử d ng công thức Reed- eunch để tính chỉ số TCID50 của virus.

Cách tính TCID50 cũng giống với cách tính EID50.

2.3.2.5. hương ph p Reed-Muench


Sử d ng bảng tổng hợp số liệu (bảng 2.1) để tính toán chỉ số EID50 hoặc TCID50.

Bảng 2.1. Bảng tổng hợp liệ tính to n theo phương ph p Reed-Muench


Độ pha loãng bao gồm cả độ pha loãng có 100% nhiễm virus (HA dương tính) và độ pha loãng không nhiễm virus

(HA âm tính)


Số trứng bị nhiễm virus (HA

dương tính)


Số trứng không nhiễm virus (HA âm tính)


https://tailieuthamkhao.com

Số tích lũy (cộng dồn)

Tỷ lệ nhiễm

virus

Nhiễm virus (A)

Không nhiễm (B)


Tổng cộng (A+B)


A/(A+B)

× 100

10-1


¯





10-2


¯






¯

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở 3589 1





¯


Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở 3589 2

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở 3589 3



10-8


¯



Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở 3589 4



Có thể bạn quan tâm!

Xem toàn bộ: Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở Việt Nam (19 trang)

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở Việt Nam - 8

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở 3589 5

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở 3589 6

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở 3589 7

Công thức tính như sau:


Tỷ lệ nhiễm cận trên 50% - 50

Chỉ số =

(Tỷ lệ nhiễm cận trên 50%) – Tỷ lệ nhiễm cận dưới 50%)

Giá trị EID50 và TCID50 được tính hiệu giá pha loãng cận trên 50% cộng với chỉ số tính được trên. Ví d nếu tính được chỉ số là 0, với độ pha loãng virus cao nhất có tỷ lệ nhiễm 0% là 10-7, thì chuẩn độ của virus sẽ là 10-7,5.

2.3.2.6. hương ph p gây bệnh cho đ ng vật thí nghiệm (gà, vịt và ngan)

- Sử d ng gà, vịt và ngan 4-10 tuần tuổi khoẻ mạnh.

- Kiểm tra kháng thể cúm gia cầm H trước khi gây bệnh (công cường độc) chỉ sử d ng gia cầm không có kháng thể kháng virus cúm gia cầm H5N1.

- Gây nhiễm virus qua đường mũi b ng cách nhỏ 0,2 ml hỗn dịch virus (nước niệu mô từ phôi trứng sau khi phân lập chứa virus được pha loãng 1 10 với dung dịch PBS pH7,2) hoặc dùng liều gây nhiễm là 10-6 TCID50.

- Theo dõi trong vòng 10 ngày để đánh giá độc lực của virus. (Theo

phương pháp của OIE, virus được đánh giá là có độc lực cao-HPAI nếu giết chết ít nhất % số gà gây nhiễm sau thời gian theo dõi.

2.3.2.7. hương ph p HA, HI gi định i à x c định đặc tính kh ng ng yên củ i c A/H5N1 clade 7 (OIE, 1992; OIE 2012).

- Phương pháp HA: tiến hành phản ứng trên đĩa microtiter 96 giếng đáy V (tổng lượng hỗn dịch phản ứng là µl giếng).

+ Cho 25 µl dung dịch PBS pH ,2 vào các giếng của đĩa phản ứng

+ Cho 25 µl dung dịch chứa virus (nước trứng) vào giếng thứ nhất và bắt đầu pha loãng kháng nguyên virus theo cơ số 2 từ giếng thứ 1 đến giếng thứ 11

+ Nhỏ 25 µl dung dịch PBS vào các giếng từ 1đến giếng thứ 12

+ Nhỏ 25 µl dung dịch hồng cầu gà 1% (lấy từ gà trống khỏe mạnh) vào các giếng từ giếng 1-12. Để 15-30 phút nhiệt độ phòng và đọc kết quả ngưng kết.

+ Hiệu giá ngưng kết hồng cầu gà (HA) là nồng độ pha loãng cao nhất còn có hiện tượng ngưng kết toàn phần.

- Phương pháp HI: cũng được tiến hành trên đĩa microtiter 96 giếng đáy

V. Sau khi đã biết hiệu giá HA của virus, virus được pha thành dung dịch kháng nguyên có chứa 4 đơn vị HA.

+ Cho 25 µl dung dịch PBS pH ,2 vào các giếng của đĩa phản ứng

+ Cho 25 µl kháng huyết thanh chuẩn A/H N1 đã biết được pha loãng với PBS theo cơ số 2.

+ Sau đó nhỏ vào mỗi giếng 25 µl dung dịch kháng nguyên 4 đơn vị HA, để nhiệt độ phòng 30 phút,

+ Tiếp t c nhỏ 25 µl dung dịch hồng cầu gà 1% vào các giếng, để 15-30 phút và đọc kết quả.

+ Hiệu giá ngăn tr ngưng kết hồng cầu (HI) là độ pha loãng cao nhất của huyết thanh còn có hiện tượng ức chế hoàn toàn ngưng kết hồng cầu.

Khi tiến hành phản ứng HI với kháng huyết thanh chế từ chồn (ferret), huyết thanh được pha loãng trước 1/10, rồi tiếp t c pha theo cơ số 2.

2.3.2.8. h t hiện virus bằng phản ứng realtime RT-PCR

a. Chiết t ch RNA của virus c A/H5N1 bằng kít Qi gen RNe y minikit. T ình tự c c bước

Chuẩn bị

Chuẩn bị dung môi LT (600µl/mẫu) vào ống ly tâm 0ml. Thêm 1 100 β-

ercaptoethanol (β-ME) vào dung môi LT.

Dung môi này có thể bảo quản 1 tháng nhiệt độ phòng. Tiến hành tách chiết

- Lắc vortex mẫu trong giây và ly tâm nhanh (spin down).

- Cho 600 µl dung môi LT đã bổ sung β- E vào ống eppendorf 1,5 ml.

- Chuyển 200 µl mẫu sang ống 1,5.

- Lắc vortex trong 1 giây và ly tâm nhanh .

- Cho 400 µl cồn tuyệt đối 100%, và lắc vortex trong 1 giây.

- (Ly tâm với tốc độ 10.000 vòng phút trong 1 phút nhiệt độ phòng)

- Đặt ống cột lọc (spin column) vào hệ thống hút chân không.

- Chuyển tất cả dung dịch mẫu sang cột lọc và bật máy hút.

Rửa lần 1

- Cho 00 µl dung môi W1 vào cột lọc và bật máy hút cho đến khi hút hết lượng mẫu trong cột lọc.

Rửa lần 2

- Cho 00µl dung môi PE vào cột lọc và bật máy hút cho đến khi hút hết lượng mẫu trong cột lọc.

- Cho tiếp 00 µl dung môi PE vào cột lọc và bật máy hút cho đến khi hút hết lượng mẫu trong cột lọc.

- Đặt cột lọc vào ống thu mới (collection tube)

- Ly tâm cột lọc với tốc độ 12000 vòng phút trong 2 phút Thu RNA

- Chuyển cột lọc sang ống 1.5ml eppendorf mới.

- Cho 50l nước (RNase-free H2O) vào cột lọc, đợt 1 phút.

- Ly tâm 1 phút tốc độ >10.000 phòng phút

- Chuyển mẫu NA đã thu sang ống 1.5ml mới.

Cất giữ RNA

Có thể giữ RNA 40C trong vài giờ nếu xét nghiệm ngay. Cất giữ nhiệt độ -200C nếu chưa dùng ngay trong ngày để bảo quản RNA.

b. Thực hiện phản ứng Realtime RT-PCR (RRT-PCR) sử dụng p i e à probe matrix thiết kế đặc hiệu cho virus c A/H5N1 (theo quy trình chẩn đoán - TCN)

Bảng 2.2. i e à p obe đ ph t hiện i c gi cầ A/H5N1


Primer/

Probe

Chuỗi n cleotide (5’-3’

Đầu

5’

3’

Probe

TGCAGTCCTCGCTCACTGGGCACG

FAM

BHQ1

Xuôi

CATGGARTGGCTAAAGACAAGACC



Ngược

AGGGCATTTTGGACAAAKCGTCTA



Bảng 2.3. Ch ẩn bị ix (hỗn hợp phản ứng cho Re lti e RT-PCR


Invitrogen superscriptIII qRT-PCR kit

Reagent

Lượng (µl)

Nước Rnase/Dnase free

4.5

2x Reaction buffer

12.5

MgCl2 (50mM)

1.0

Forward primer (20 μ )

0.5

Reverse primer (20 μ )

0.5

Probe

0.5

Enzyme mix

0.5

- Cho 20 µl master mix vào ống PCR.

- Cho µl mẫu NA vào ống PCR.

- Đặt ống PC vào máy real-time PCR machine.

- Chạy chương trình.

- Chọn đọc màu bước kéo dài (annealing).

Ch t ình nhiệt của phản ứng:

- 50oC - 15 phút

- 95oC- 2 phút

- 40 chu kỳ (95oC-10 giây + 58oC-50 giây)

Đọc kết quả:

Kết quả xét nghiệm được công nhận khi:

- Đối chứng dương tính cho giá trị Ct (Cycle threshold – ngưỡng vòng) đã biết (±2),

- Đối chứng âm tính không có Ct

- Mẫu được coi là dương tính khi có Ct 35

- Mẫu được coi là âm tính nếu không có Ct

- Mẫu được coi là nghi ngờ nếu Ct >35

2.3.2.9. hương ph p là tiê bản xét nghiệm bệnh tích i th

Các mẫu phủ tạng cắt mỏng 0, cm ngâm trong dung dịch formol 10% trong 24 giờ.

Lấy các miếng tổ chức cố định trong formol ra cắt mỏng 2 - 3mm, rửa dưới vòi nước chảy trong 2 – 3 giờ cho hết formol thừa.

Chuyển sang ngâm trong cồn 70% thời gian 2 – 3 giờ. Ngâm sang cồn 900 trong 2 – 3 giờ.

Ngâm sang cồn tuyệt đối 2 – 3 lần, mỗi lần 2 – 3 giờ. Ngâm sang xylen 1 để trong 2 – 3 giờ.

Ngâm sang xylen 2 để trong 2 – 3 giờ. Ngâm tẩm nến 3 lần, mỗi lần 2 – 3 giờ. Đúc khuôn.

Cắt tiêu bản:

Cắt gọt khối block nến vuông, mặt cắt b ng phẳng, để trên mặt khay đá lạnh khoảng 5 – 10 phút.

Đặt mặt khối block nến song song với mép lưỡi dao, cắt chiều dày lát cắt 3 – µm.

Chọn lát cắt tiêu bản phẳng thả vào nồi chưng cất nhiệt độ nước 30 - 350C; Dùng lam kính chọn lát cắt giãn phẳng, không bị nếp nhăn, dựng nghiêng, để vào tủ ấm 370C cho khô.

Nhuộm tiêu bản H&E (Hematoxylin-Eozin)

Lấy lam kính ra khỏi tủ ấm, tẩy nến trong xylen 3 lần, mỗi lần 3 – phút. Ngâm trong cồn tuyệt đối 3 – phút.

Ngâm sang cồn 90% để 3 – phút. Ngâm sang cồn 70% để 3 – phút. Rửa dưới vòi nước chảy 3 – phút. Nhuộm Haematoxylin 1 – 5 phút.

Rửa dưới vòi chảy 3 – phút. Nhuộm Eosin 60 – 90 giây.

Rửa dưới vòi nước chảy 2 – 3 phút.

Để khô trong nhiệt độ phòng (hoặc ngâm trong cồn 900 rồi đến cồn tuyệt đối), chuyển sang xylen 2 lần (mỗi lần 2 – 3 phút), gắn lamen b ng Balm canada. Để khô, soi kính. Soi kiểm tra dưới kính hiển vi.

2.3.2.10. hương ph p hó iễn dịch

Cắt tiêu bản dày 4µm, dán lên phiến kính

Để tiêu bản khô qua đêm trong tủ ấm 49 độ C, sau đó để 10 phút nhiệt độ 60 độ C

Tẩy nến: ngâm qua 3 cốc xylen, 3 cốc cồn tuyệt đối, 1 cốc cồn 70% (mỗi cốc 2 phút). Sau đó rửa trong dòng nước chảy. Để vào nước cất nếu cần thiết

Đặt tiêu bản vào khay, rửa tiêu bản b ng Tris buffer

Nhỏ 200µl H2O2 cho mỗi tiêu bản. Để trong 10 phút, sau đó rửa b ng dung dịch Tris buffer

Nhỏ 200µl Proteinase K. Để trong phút, sau đó rửa b ng dung dịch Tris buffer

Nhỏ 200µl kháng thể 1 (kháng virus cúm gia cầm chế trên chuột) cho mỗi tiêu bản. Để trong 1 giờ, sau đó rửa b ng dung dịch Tris buffer

Nhỏ 200µl kháng thể 2 (DAKO envision reagent – anti – mouse) cho mỗi tiêu bản. Để trong 4 phút, sau đó rửa b ng dung dịch Tris buffer

Nhỏ 200µl dung dịch AEC cho mỗi tiêu bản (DAKO AEC + substrate chromagen). Để trong 2-3 phút, kiểm tra màu b ng kính hiển vi. Dừng phản ứng b ng cách rửa qua nước cất.

Bài viết tương tự

Gửi tin nhắn

Bài viết tương tự

Bài viết mới

Home | Contact | About | Terms | Privacy policy
© 2022 Tailieuthamkhao.com | all rights reserved

Trang chủ Tài liệu miễn phí