Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở Việt Nam - 20

Digg Facebook Google LinkedIn Pinterest Reddit Tumblr Twitter
1

Nội dung:

A/CHICKEN/VIETNAM/NCVD-016/200 AAAAGGGTTTTCATTTAAATACGGCAATGGTGTTTGGATCGGGAGAACCAAAAGCACTAATTCCAGGAGC A/CHICKEN/VIETNAM/NCVD-03/2008 ......................................................................

A/CHICKEN/VIETNAM/NCVD-04/2008 ......................................................................

A/CHICKEN/VIETNAM/NCVD-05/2008 ......................................................................

A/CHICKEN/VIETNAM/NCVD-093/200 ......................................................................


1060 1070 1080 1090 1100 1110 1120

....|....|....|....|....|....|....|....|....|....|....|....|....|....| A/CHICKEN/VIETNAM/NCVD-016/200 GGTTTTGAAATGATTTGGGATCCAAATGGGTGGACTGAAACGGACAGCAGCTTTTCGATGAAGCAAGATA A/CHICKEN/VIETNAM/NCVD-03/2008 .....................................G................................

A/CHICKEN/VIETNAM/NCVD-04/2008 .....................................G................................

A/CHICKEN/VIETNAM/NCVD-05/2008 .....................................G................................

A/CHICKEN/VIETNAM/NCVD-093/200 ..C....................G.............G...................G............


1130 1140 1150 1160 1170 1180 1190

....|....|....|....|....|....|....|....|....|....|....|....|....|....| A/CHICKEN/VIETNAM/NCVD-016/200 TCGTAGCAATAACTGATTGGTCAGGATATAGCGGGAGTTTTGTTCAGCATCCAGAACTGACAGGATTAGA A/CHICKEN/VIETNAM/NCVD-03/2008 ....G......................................C..........................

A/CHICKEN/VIETNAM/NCVD-04/2008 ....G......................................C..........................

A/CHICKEN/VIETNAM/NCVD-05/2008 ....G......................................C..........................

A/CHICKEN/VIETNAM/NCVD-093/200 ...........................................C..........................


1200 1210 1220 1230 1240 1250 1260

....|....|....|....|....|....|....|....|....|....|....|....|....|....| A/CHICKEN/VIETNAM/NCVD-016/200 TTGCATAAGACCTTGTTTCTGGGTTGAGTTGGTCAGAGGGCGGCCCAAAGAGAGCACAATCTGGACTAGT A/CHICKEN/VIETNAM/NCVD-03/2008 ..................T.................................G.................

A/CHICKEN/VIETNAM/NCVD-04/2008 ..................T...........A..........A..........G.................

A/CHICKEN/VIETNAM/NCVD-05/2008 ..................T...........A..........A..........G.................

A/CHICKEN/VIETNAM/NCVD-093/200 ..............................A.......................................


1270 1280 1290 1300 1310 1320 1330

....|....|....|....|....|....|....|....|....|....|....|....|....|....| A/CHICKEN/VIETNAM/NCVD-016/200 GGGAGCAGCATATCTTTTTGTGGTGTAAATAGTGACACTGTGAGTTGGTCTTGGCCAGACGGTGCTGAGT A/CHICKEN/VIETNAM/NCVD-03/2008 ..............C.......................................................

A/CHICKEN/VIETNAM/NCVD-04/2008 ..............C.......................................................

A/CHICKEN/VIETNAM/NCVD-05/2008 ..............C.......................................................

A/CHICKEN/VIETNAM/NCVD-093/200 ..............C...........................G..........................G


1340 1350

....|....|....|....|... A/CHICKEN/VIETNAM/NCVD-016/200 TGCCATTCACCATTGACAAGTA- A/CHICKEN/VIETNAM/NCVD-03/2008 ......................-

A/CHICKEN/VIETNAM/NCVD-04/2008 ......................-

A/CHICKEN/VIETNAM/NCVD-05/2008 ......................-

A/CHICKEN/VIETNAM/NCVD-093/200 ......................-


3) T ình tự gen M củ c c i c A/H5N1HA clade 7

10 20 30 40 50 60 70

....|....|....|....|....|....|....|....|....|....|....|....|....|....|

A/CHICKEN/VIETNAM/NCVD-016/200 ......................................................................

A/CHICKEN/VIETNAM/NCVD-03/08 ......................................................................

A/CHICKEN/VIETNAM/NCVD-04/08 ......................................................................

A/CHICKEN/VIETNAM/NCVD-05/08 ...................................................................... A/CHICKEN/VIETNAM/NCVD-093/08 ATGAGTCTTCTAACCGAGGTTGAAACGTACGTTCTCTCTATCATCCCGTCAGGCCCCCTCAAAGCCGAGA


80 90 100 110 120 130 140

....|....|....|....|....|....|....|....|....|....|....|....|....|....|

A/CHICKEN/VIETNAM/NCVD-016/200 ......................................................................

A/CHICKEN/VIETNAM/NCVD-03/08 ......................................................................

A/CHICKEN/VIETNAM/NCVD-04/08 ......................................................................

A/CHICKEN/VIETNAM/NCVD-05/08 ...................................................................... A/CHICKEN/VIETNAM/NCVD-093/08 TAGCGCAAAAACTTGAAGATGTTTTCGCAGGAAAGAACACTGATCTCGAGGCTCTCATGGAGTGGCTAAA


150 160 170 180 190 200 210

....|....|....|....|....|....|....|....|....|....|....|....|....|....|

A/CHICKEN/VIETNAM/NCVD-016/200 ......................................................................

A/CHICKEN/VIETNAM/NCVD-03/08 ...................................................................... https://tailieuthamkhao.com

A/CHICKEN/VIETNAM/NCVD-04/08 ................................................G.....................

A/CHICKEN/VIETNAM/NCVD-05/08 ................................................G..................... A/CHICKEN/VIETNAM/NCVD-093/08 GACAAGACCAATCCTGTCACCTCTGACTAAAGGGATTTTGGGATTTGTATTCACGCTCACCGTGCCCAGT


220 230 240 250 260 270 280

....|....|....|....|....|....|....|....|....|....|....|....|....|....|

A/CHICKEN/VIETNAM/NCVD-016/200 ....................T.................................................

A/CHICKEN/VIETNAM/NCVD-03/08 ......................................................................

A/CHICKEN/VIETNAM/NCVD-04/08 ......................................................................

A/CHICKEN/VIETNAM/NCVD-05/08 ...................................................................... A/CHICKEN/VIETNAM/NCVD-093/08 GAGCGAGGACTGCAGCGTAGACGCTTTGTCCAGAATGCCCTAAGTGGAAATGGAGATCCAAATAATATGG

290 300 310 320 330 340 350

....|....|....|....|....|....|....|....|....|....|....|....|....|....|

A/CHICKEN/VIETNAM/NCVD-016/200 ..........................................................G...........

A/CHICKEN/VIETNAM/NCVD-03/08 ......................................................................

A/CHICKEN/VIETNAM/NCVD-04/08 ......................................................................

A/CHICKEN/VIETNAM/NCVD-05/08 ...................................................................... A/CHICKEN/VIETNAM/NCVD-093/08 ATAGGGCAGTTAAGCTATATAAGAAGCTGAAAAGAGAAATAACATTCCATGGGGCTAAAGAGGTCGCACT


360 370 380 390 400 410 420

....|....|....|....|....|....|....|....|....|....|....|....|....|....|

A/CHICKEN/VIETNAM/NCVD-016/200 ............C.........................................................

A/CHICKEN/VIETNAM/NCVD-03/08 .....................................................................A

A/CHICKEN/VIETNAM/NCVD-04/08 ......................................................................

A/CHICKEN/VIETNAM/NCVD-05/08 ...................................................................... A/CHICKEN/VIETNAM/NCVD-093/08 CAGCTACTCAACTGGTGCACTTGCCAGTTGCATGGGTCTCATATACAACAGAATGGGAACGGTAACTACG


430 440 450 460 470 480 490

....|....|....|....|....|....|....|....|....|....|....|....|....|....|

A/CHICKEN/VIETNAM/NCVD-016/200 .................G....................................................

A/CHICKEN/VIETNAM/NCVD-03/08 ......................................................................

A/CHICKEN/VIETNAM/NCVD-04/08 ......................................................................

A/CHICKEN/VIETNAM/NCVD-05/08 ...................................................................... A/CHICKEN/VIETNAM/NCVD-093/08 GAAGTAGCTTTTGGTTTAGTGTGTGCCACTTGTGAGCAGATTGCAGATTCACAGCATCGGTCTCACAGAC


500 510 520 530 540 550 560

....|....|....|....|....|....|....|....|....|....|....|....|....|....|

A/CHICKEN/VIETNAM/NCVD-016/200 ....................................................G.................

A/CHICKEN/VIETNAM/NCVD-03/08 ......................................................................

A/CHICKEN/VIETNAM/NCVD-04/08 ......................................................................

A/CHICKEN/VIETNAM/NCVD-05/08 ...................................................................... A/CHICKEN/VIETNAM/NCVD-093/08 AGATGGCAACTATCACCAACCCACTAATCAGGCATGAGAACAGAATGGTGCTAGCCAGCACTACAGCTAA


570 580 590 600 610 620 630

....|....|....|....|....|....|....|....|....|....|....|....|....|....|

A/CHICKEN/VIETNAM/NCVD-016/200 ...C.........................................C........................

A/CHICKEN/VIETNAM/NCVD-03/08 .............................................C........................

A/CHICKEN/VIETNAM/NCVD-04/08 .............................................C........................

A/CHICKEN/VIETNAM/NCVD-05/08 .............................................C........................ A/CHICKEN/VIETNAM/NCVD-093/08 GGCTATGGAGCAGATGGCGGGATCAAGTGAGCAGGCAGCGGAAGCAATTGAGATCGCTAATCAGGCTAGG


640 650 660 670 680 690 700

....|....|....|....|....|....|....|....|....|....|....|....|....|....|

A/CHICKEN/VIETNAM/NCVD-016/200 ........................................................A.............

A/CHICKEN/VIETNAM/NCVD-03/08 ......................................................................

A/CHICKEN/VIETNAM/NCVD-04/08 ......................................................................

A/CHICKEN/VIETNAM/NCVD-05/08 ...................................................................... A/CHICKEN/VIETNAM/NCVD-093/08 CAGATGGTGCAGGCAATGAGGACAATTGGGACTCATCCTAACTCTAGTGCTGGTCTGAGGGACAATCTTC


710 720 730 740 750 760 770

....|....|....|....|....|....|....|....|....|....|....|....|....|....|

A/CHICKEN/VIETNAM/NCVD-016/200 ......................................................................

A/CHICKEN/VIETNAM/NCVD-03/08 ......................................................................

A/CHICKEN/VIETNAM/NCVD-04/08 ......................................................................

A/CHICKEN/VIETNAM/NCVD-05/08 ...................................................................... A/CHICKEN/VIETNAM/NCVD-093/08 TTGAAAATTTGCAGGCCTACCAGAAACGAATGGGAGTGCAGATGCAGCGATTCAAGTGATCCTCTTGTTG


780 790 800 810 820 830 840

....|....|....|....|....|....|....|....|....|....|....|....|....|....|

A/CHICKEN/VIETNAM/NCVD-016/200 ......................................................................

A/CHICKEN/VIETNAM/NCVD-03/08 ......................................................................

A/CHICKEN/VIETNAM/NCVD-04/08 ......................................................................

A/CHICKEN/VIETNAM/NCVD-05/08 ...................................................................... A/CHICKEN/VIETNAM/NCVD-093/08 TTGCCGCAAATATCATTGGGATCTTGCACTTGATATTGTGGATTCTTGATCATCTTTTCTTCAAATGCAT


850 860 870 880 890 900 910

....|....|....|....|....|....|....|....|....|....|....|....|....|....|

A/CHICKEN/VIETNAM/NCVD-016/200 ............................................T.........................

A/CHICKEN/VIETNAM/NCVD-03/08 ......................................................................

A/CHICKEN/VIETNAM/NCVD-04/08 ......................................................................

A/CHICKEN/VIETNAM/NCVD-05/08 ...................................................................... A/CHICKEN/VIETNAM/NCVD-093/08 TTATCGTCGCCTTAAATACGGTTTGAAAAGAGGGCCTTCTACGGCAGGGGTACCTGAGTCTATGAGGGAA


920 930 940 950 960 970 980

....|....|....|....|....|....|....|....|....|....|....|....|....|....|

A/CHICKEN/VIETNAM/NCVD-016/200 ..G...................................................................

A/CHICKEN/VIETNAM/NCVD-03/08 ..G...................................................................

A/CHICKEN/VIETNAM/NCVD-04/08 ..G...................................................................

A/CHICKEN/VIETNAM/NCVD-05/08 ..G................................................................... A/CHICKEN/VIETNAM/NCVD-093/08 GAATACCGGCAGGAACAGCAGAGTGCTGTGGATGTTGACGACGGTCATTTTGTCAACATAGAGTTGGAGT

SỐ ĐĂNG KÝ NGÂN HÀNG GEN CAC CHỦNG VI US CÚ A H N1 CLADE 7 CỦA VIỆT NAM (SỬ DỤNG T ONG NGHIÊN CỨU)



Tên chủng

Số đăng ký gen

HA (GenBank)

Số đăng ký full

Genome (GISAID)

A/Chicken/Vietnam/NCVD-016/2008

FJ842476

EPI_ISL_28830

A/chicken/Vietnam/NCVD-03/2008

FJ842481

EPI_ISL_80638

A/chicken/Vietnam/NCVD-04/2008

FJ842482

EPI_ISL_80639

A/chicken/Vietnam/NCVD-05/2008

FJ842483

EPI_ISL_80640

A/chicken/Vietnam/NCVD-093/2008

FJ842480

EPI_ISL_80641

A/chicken/Vietnam/NCVD-swab06/2008

FJ842484


A/chicken/Vietnam/NCVD-swab15/2008

FJ842477


A/chicken/Vietnam/NCVD-swab16/2008

FJ842485


A/chicken/Vietnam/NCVD-swab17/2008

FJ842478


A/chicken/Vietnam/NCVD-swab18/2008

FJ842479


A/chicken/Vietnam/NCVD-swab19/2008

FJ842486


A/chicken/Vietnam/NCVD-swab20/2008

FJ842487


A/chicken/Vietnam/NCVD-swab24/2008

FJ842488


A/chicken/Vietnam/NCVD-swab25/2008

FJ842489


A/chicken/Vietnam/NCVD-swab26/2008

FJ842490


Có thể bạn quan tâm!

Xem toàn bộ 162 trang: Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở Việt Nam

Nghiên cứu một số đặc tính sinh học của vi rút cúm A/H5N1 Clade 7 phân lập ở Việt Nam - 20

Bài viết tương tự

Gửi tin nhắn

Danh mục

Bài viết tương tự

Bài viết mới

Home | Contact | About | Terms | Privacy policy
© 2022 Tailieuthamkhao.com | all rights reserved

Trang chủ Tài liệu miễn phí